Detection of apoptosis during planarian regeneration and TUNEL assay(1).pdf

Detection of apoptosis during planarian regeneration by theexpression of apoptosis-related genes and TUNEL assayJung Shan Hwanga,Chiyoko Kobayashib,Kiyokazu Agatab,Kazuho Ikeoa,Takashi Gojoboria,*aCenter for Information Biology and DNA Data Bank of Japan,National Institute of Genetics,Yata 1111,Mishima,Shizuoka 411-8540,JapanbLaboratory for Evolutionary Regeneration Biology,Center for Developmental Biology,RIKEN Kobe,Kobe,Hyogo 650-0047,JapanReceived 10 July 2003;received in revised form 27 August 2003;accepted 5 February 2004Available online 20 April 2004AbstractApoptosis is a tightly organized cell death process that plays a crucial role in metazoan development,but it has not yet been revealedwhether apoptotic events are involved in the process of regeneration.Here,we tried to detect apoptotic cells during planarian regenerationusing the TdT-mediated dUTP nick-end labeling(TUNEL)assay as well as the expression of apoptosis-related genes.Three novel cDNAswere isolated from a planarian cDNA library and shown to be closely related to other metazoan caspases at the amino acid sequence level.One of these cDNAs,Caspase-like gene 3(DjClg3),was expressed primarily in apoptotic cells by double detections with the TUNEL assay.Whole mount in situ studies indicated that DjClg3 was expressed in the cells of the mesenchymal space and also around the pharynx of theintact body.Its expression in the regenerating head piece was seen in the blastema and less significantly in the brain,while in the regeneratingtail piece,DjClg3 expression was detected uniformly throughout the entire region.In parallel experiments,we performed in situ TUNELassays to localize the regions where cell death occurred during regeneration and comparable results to the DjClg3 expression patterns wereobtained.This is the first report to show that planarians have apoptosis-related genes and the results suggest that the apoptotic mechanismprobably takes place to a large extent in normal intact worms as well as during their regeneration.We hypothesize that the presence ofapoptosis in planarians may have a role in controlling cell numbers,eliminating unnecessary tissues or cells and remodeling the old tissues ofregenerating body parts.D 2004 Elsevier B.V.All rights reserved.Keywords:Caspase;Programmed cell death;Platyhelminthes;Blastema;Remodeling1.IntroductionApoptosis,or in a more general term,programmed celldeath,has been known to play a fundamental role in thedevelopmental biology and embryogenesis of metazoans(Jacobson et al.,1997;Meier et al.,2000;Baehrecke,2002).Apoptosis acts like a guardian which controls theprecise number of cells for different types of organs ortissues and directs the morphological reorganization,avoid-ing mispatterning during development(Rusconi et al.,2000;Schaller et al.,2001).Obviously,this basic mechanism ishighly conserved throughout metazoan evolution.The phe-nomenon of apoptosis has been observed in the develop-mental stages of many invertebrates such as Porifera,Cnidarian,Echinoderm,Nematoda and Arthropods(Wienset al.,2000;Miller et al.,2000;Seipp et al.,2001;Voroninaand Wessel,2001;Metzstein et al.,1998;Richardson andKumar,2002;Brachmann and Cagan,2003).Nevertheless,genes related to apoptosis have so far only been identifiedand discussed extensively in C.elegans and Drosophila,and discussed to some extent in sponges(Wiens et al.,2000,2003)and hydra(Cikala et al.,1999).The lack of informa-tion at the molecular level makes it difficult to study themechanism of apoptosis,particularly in the lower inverte-brates,with respect to their development.The freshwater flatworms,planarians,which belong tothe phylum Platyhelminthes,are ideal animals for the0378-1119/$-see front matter D 2004 Elsevier B.V.All rights reserved.doi:10.1016/j.gene.2004.02.034Abbreviations:EST,expressed sequence tag;RACE,rapid amplifica-tion of cDNA ends;TUNEL,TdT-mediated dUTP nick-end labeling;TdT,terminal deoxynucleotidyl transferase;NBT,4-nitroblue tetrazoliumchloride;BCIP,5-bromo-4-chloro-3-indolyl-phosphate;DAPI,4V,6-diami-dino-2-phenylindole;DAD-1,defender against cell death 1;IAP-1,inhibitor of apoptosis protein 1;RNAi,RNA interference.*Corresponding author.Tel.:+81-559-81-6847;fax:+81-559-81-6848.E-mail address:tgojoborgenes.nig.ac.jp(T.Gojobori) 333(2004)1525study of apoptosis in metazoan evolution since they areprimitive organisms with a phylogenetic position near thebase of the lineage of protostomes(Finnerty and Martin-dale,1998;de Rose et al.,1999;Peterson et al.,2000;Peterson and Eernisse,2001).Moreover,the regenerativeability of planarians is well known,in which blastemaformation,cell differentiation,AP axial polarity and re-construction of lost parts are the central issues for manyresearchers(Agata and Watanabe,1999;Newmark andSa nchez Alvarado,2002;Agata et al.,2003).We believethat apoptosis is definitely a key issue to the patterning ofdevelopment and also in planarian regeneration.It is ofparticular interest to know whether the apoptosis possiblytaking place in planarian regeneration has a sophisticated,comprehensive process that is well developed,like thatseen in vertebrates.A set of expressed sequence tags(ESTs)data wasconstructed with a cDNA library derived from the headpart of Dugesia japonica,which is a clonal strain propa-gating by asexual reproduction in the laboratory(Mineta etal.,2003).Using the ESTs data,we identified three apo-ptosis-related cDNAs from an intact planarian cDNA li-brary and characterized their sequences by conductinghomology searches and a phylogenetic analysis.In thesecond part of the paper,we examined the expressionpatterns of one of these three apoptosis-related genes atdifferent stages of regeneration and compared its expressionpatterns with the TUNEL-positive regions in intact andregenerating planarians.2.Materials and methods2.1.Animals and regenerating bodiesThe asexual clonal strain,D.japonica,used in thisstudy was obtained from the Irima River,Gifu Prefecture,Japan.They were cultured in autoclaved tap water in thedark at 2223 jC and fed once a week with chicken livers.To study planarian regeneration,animals having a length of68 mm were starved for at least 7 days before theamputation.Starved planarians were cut transversely atthe postcephalic and postpharyngeal levels,and then leftto regenerate without feeding(in autoclaved tap water at2223 jC).2.2.Isolation and sequencing of DjClg1,2 and 3 cDNAs2.2.1.Screening of a cDNA libraryAn intact planarian cDNA library was constructedaccording to the manufacturers protocol(SMART cDNALibrary Construction Kit,Clontech).Caspase-like gene 1(DjClg1),2 and 3 were isolated from the library using aPCR-based strategy(Bockmann et al.,1998)to minimizethe labor cost,followed by the conventional plaque liftingmethod(Benton and David,1977).The two primer pairsused for the PCR-based screening were derived from theEST database and their sequences were as follows:DjClg1/2F 5V CTGGGAGGCACTGATGATGCTGAT-CG3VDjClg1/2R 5VATTCTCCTCCACGACAAGCAGCTAC 3VDjClg3F 5V GAAAATAAGAGTGCAGAGGCGATGG 3VDjClg3R 5VCCGTCAAACCCAGATCAGTCCGAAC3VThe plaque lifting method was performed by screeningthe positive clones with DIG-labeled DNA probes accord-ing to the manufacturers instructions(Roche).DIG-la-beled DNA probes were generated by PCR using the samesets of primer pairs shown above.Isolated clones wereinserted into the pTriplEx2 vector(Clontech),sequencedon both strands using a Big-Dye Termination Kit(PerkinElmer)and electrophorized using an automated ABI 377sequencer.2.2.2.5VRACETo ensure the sequence at the 5Vregion of cDNA,5V RACE was carried out using a 5V-Full RACE Core Set(Takara).The sequence 5VACCATGAGACAGAATTATA-CAGACGAG 3Vcorresponding to LVCIILSHG was usedas a universal primer to make the first strand cDNA ofDjClg1,2 and 3,and then the single stranded cDNA wascircularized with T4 RNA ligase and amplified by two-round PCRs using three pairs of primers which werespecific for each clone.2.3.Sequence alignment and phylogenetic analysisExcluding hypothetical proteins,59 amino acid sequen-ces of the peptidase C14(or large or ICE_p20)domainwere obtained from the Pfam(St.Louis,version 8.0).Regions outside of peptidase C14 show great sequencevariation among species,especially in the N-terminaldomain.With the addition of the three DjClg sequences,a total of 62 sequences of peptidase C14 were alignedusing ClustalX,and the subsequent phylogenetic tree wasviewed by TreeView.2.4.Preparation of tissue and cell samples2.4.1.Dissociated cellsThe protocol for obtaining dissociated cells was de-scribed in Asami et al.(2002).Briefly,planarians were cutinto small pieces.The endogenous proteases were inacti-vated by 30 Ag/ml of trypsin inhibitor(Sigma)at RT for 10min.Planarian fragments were further chopped,resus-pended in 0.25%trypsin(DIFCO),incubated at 20 jCfor 1 h and then centrifuged at 4000 rpm for 2 min.Thecell pellet was further dissociated by resuspension in 5/8 Holtfreter buffer.Dissociated cells were filtered through a40 Am pore size filter,followed by fixation in 4%para-formaldehyde at 4 jC for 30 min before spreading on aglass slide.J.S.Hwang et al./Gene 333(2004)1525162.4.2.Paraffin sectionsParaffin sections for TUNEL and in situ hybridizationwere prepared as previously described by Kobayashi et al.(1998).2.5.TUNEL reactionAll sample slides were pretreated before the TUNELreaction.For dissociated cells,slides were incubated in0.1%Triton X-100 in 0.1%sodium citrate for 2 min onice,while for paraffin sections,slides were immersed in 0.1M citrate buffer(pH 6.0)and then microwave-irradiated at250 W for 5 min.Slides were pre-incubated in the terminaldeoxynucleotidyl transferase(TdT)buffer(GIBCO BRL)atRT for 30 min and then incubated in the TUNEL reactionmix(In Situ Cell Death Detection Kit,AP.,Roche)at 37 jCfor 60 min.Following 3 washes in PBS buffer,slides wereincubated with anti-fluorescein-AP(Roche)at 37 jC for 30min and again rinsed three times in PBS buffer.The colorwas developed with phosphatase substrates,either 0.6 mg/ml 4-nitroblue tetrazolium chloride(NBT)and 0.65 mg/ml5-bromo-4-chloro-3-indolyl-phosphate(BCIP)or Fast Red(Roche)in 0.1 M TrisHCl,pH 8.2.For double detections,the first alkaline phosphatase was inactivated by two 15-minincubations in 0.1 M glycineHCl(pH 2.2),0.1%Tween20at RT before proceeding to the second detection.2.6.In situ hybridization on dissociated cellsPrehybridization was carried out at 55 jC for at least 30min.Cells were hybridized with a digoxigenin-labeledriboprobe at 55 jC for 24 h,followed by incubation withanti-digoxigenin-AP Fab fragment(Roche)according to theinstructions provided with an ELFR 97 mRNA In situHybridization Kit(Molecular Probes).The color detectionusing the ELF kit was performed with a 1:100 dilution ofthe phosphatase substrate instead of the 10-fold dilutionrecommended by the kit manual.The substrate reactionwas monitored under a fluorescent microscope and,ingeneral,could be stopped after 1015 min by rinsing withTE buffer.2.7.Whole mount in situ hybridizationWhole mount in situ hybridization was performed asdescribed previously(Umesono et al.,1999).To make theantisense and sense riboprobes,full-length cDNAs ofDjClg1,2 and 3 isolated from the cDNA library weresubcloned into pBluescript SK(+)(Stratagene).All anti-sense and sense RNA probes were labeled with digoxige-nin-UTP(Roche),and cleaned up using an RNeasy Mini Kit(QIAGEN).Approximately 100 pg/ml of an RNA probewas added to the hybridization reaction,and the hybridizedRNA strands were detected by an AP-conjugated antidigox-igenin antibody and visualized by the addition of NBT/BCIP substrates.2.8.In situ hybridization on paraffin sectionsIn situ hybridization on paraffin sections was carriedout as described by Kobayashi et al.(1998).The digox-igenin-labeled riboprobes used for the hybridization werethe same as those used for the whole mount in situhybridization.2.9.RNA interferenceThe construction of dsRNA and microinjection wereperformed as described in Cebria et al.(2002).Briefly,dsRNAs were constructed using the same plasmids used formaking the riboprobes for the whole mount in situ hybrid-ization.Intact planarians were injected with dsRNAs ofDjClg1,DjClg2 and DjClg3 individually,and also a mix-ture of all three for three consecutive days.After injectingat the last day,a portion of the animals from each type ofinjection was amputated transversely at the postcephalicand postpharyngeal levels and then left at 2223 jC toregenerate.3.Results3.1.Identification and characterization of DjClg1,2 and 3Based on sequences derived from the EST data(Minetaet al.,2003),two cDNA sequences possibly related tocaspase were identified by homology searches.We thendesigned two primer pairs(DjClg1/2F and 1/2R;DjClg3Fand 3R)and screened the full-length cDNA sequences fromthe intact planarian cDNA library using a combination ofPCR and the plaque lifting method.Four and three positiveclones were isolated using the DjClg1/2F and 1/2R primers,and DjClg3F and 3R primers,respectively.Sequence anal-ysis of these clones revealed that,for the DjClg1/2F and 1/2R primer set,one exactly matched the cDNA sequence ofthe EST clone sequence while the other three showed aslightly different sequence,and thus we named them DjClg1and DjClg2,respectively.For the DjClg3F and 3R primerset,all three sequences were identical to the EST clonesequence and were named DjClg3.In summary,a total ofthree different DjClg cDNA clones were isolated in thisstudy.The 5V-end of each clone was further confirmed using5VRACE.The translated amino acid sequences of DjClg1,2 and 3are shown in Fig.1A.All three DjClg clones isolated fromthe planarian either lack or carry a relatively short prodo-main sequence,giving predicted amino acid sequences of261,258 and 240 amino acids for DjClg1,2 and 3,respectively.The prodomain is an amino-terminal domainthat is present in all caspases but varies in size(Fig.1A).The removal of the prodomain during an apoptotic eventturns caspase into an active form,which subsequentlycarries out the proteolytic process.In addition,DjClg1,2J.S.Hwang et al./Gene 333(2004)152517Fig.1.(A)DjClg1,2 and 3 are aligned for amino acid sequence comparison.The number of amino acids is shown at the end of each sequence.Identicalresidues are typed in red.The putative Asp-X cleavage site that separates the large and small(ICE_p20 and ICE_p10,respectively)domains is marked by anasterisk.The residues conserved with other caspase families are shaded in blue and the two sequences of the large domain,LSHG and DACRG or DSKDN,which are conserved and critical in other caspases,are boxed.A schematic structure of caspase is shown above the amino acid sequences.Blocks represent thethree basic domains of caspase,prodomain,ICE_p20(large)and ICE_p10(small).The prodomain can vary in size as illustrated by the broken line.Twoconserved residue regions,LSHG and QAC(R/Q)G,are found in ICE_p20 and both histidine and cysteine(blue)are the important residues for the cataly