案例一Pyruvate kinase M2 facilitates colon cancer cell migration via the modulation of STAT3 signalling..pdf

UNCORRECTED PROOF1Pyruvate kinase M2 facilitates colon cancer cell migration via the2modulation of STAT3 signalling3PengQ1Yanga,Zongwei Lia,Rong Fua,Haili Wua,Zhuoyu Lia,b,4aInstitute of Biotechnology,Key Laboratory of Chemical Biology and Molecular Engineering of National Ministry of Education,Shanxi University,Taiyuan 030006,China5bCollege of Life Science,Zhejiang Chinese Medical University,Hangzhou 310053,Chinaa b s t r a c tQ26a r t i c l ei n f o7Article history:8Received 14 February 20149Received in revised form 15 March 201410Accepted 15 March 201411Available online xxxx12Keywords:13Colorectal cancer14PKM115PKM216Migration17Adhesion18Understanding the mechanisms of colorectal cancer(CRC)metastatic progression is essential to reducing its19morbidity and mortality.Pyruvate kinase(PK)catalyses the final step of glycolysis and has been identified as a20critical regulator of glucose consumption.However,the mechanisms and roles of PKM1 and PKM2 in the21regulation of CRC cell migration and cell adhesion remain elusive.Here,we report that PKM2 rather than22PKM1drivesCRCcellmigrationandcelladhesion,whereasPKMattenuationreversesthesephenomena.Further-23more,the overexpression of PKM2 significantly increases the expression of N-cadherin,MMP-2,MMP-9,STAT3,24Snail-2,pFAK and active 1-integrin,while E-cadherin expression is suppressed.More importantly,the results25indicated that PKM2 overexpression facilitates STAT3 nuclear translocation,and it is required for PKM2 function26in the regulation of migration and adhesion associated signalling.In addition,the dimeric form of PKM2,which27lacks the pyruvate kinase activities but possesses protein kinase activity,is critical for CRC cell migration and28cell adhesion.Overall,this study suggests that PKM2 overexpression promotes CRC cell migration and cell adhe-29sion by regulating STAT3-associated signalling and that PKM2 may serve as a therapeutic target for CRC30metastasis.31 2014 Published by Elsevier Inc.32333435361.Introduction37Unlike normal cells,tumour cells consume large amounts of glucose38and produce more lactate to generate energy rather than using oxida-39tive phosphorylation,even when oxygen is abundant 1.Because the40efficiency of glycolysis in generating ATP is much lower than that of ox-41idativephosphorylation,tumourcellsdemonstratea highrateof glycol-42ysis to maintain energy balance.This obvious metabolic feature is43termedtheWarburgeffectoraerobicglycolysis,whichprovidestumour44cells energy and metabolic intermediates for the synthesis of lipids,45amino acids,nucleic acids and other macromolecules to facilitate tu-46mour cell growth and survival 2.However,the exact reason why can-47cer cells prefer glycolysis has not yet been elucidated.Recent studies48indicate that pyruvate kinase type M2(PKM2),which is often upregu-49lated in cancer cells,plays an important role in the Warburg effect 3.50Pyruvate kinase(PK)is a rate-limiting enzyme in the final step of the51glycolytic pathwaythatcatalyses theconversionfromphosphoenolpyr-52uvate(PEP)and ADP topyruvate and ATP.There are fourisoformsof PK53inmammals:PKL,whichisexpressedinliverandkidneys;PKR,whichis54present in red blood cell;PKM1,which is mainly expressed in the skel-55etal muscle,brain and heart;and PKM2,which is expressed in prolifer-56ating cells,embryonic cells and tumours 47.The expression and57distribution of these isoforms might reflect its tissue specificity.PKM158and PKM2 differ at 23 of 531 amino acids due to alternative splicing of59the PKM gene by hnRNP A1/2 and polypyrimidine-tract binding(PTB)60protein splicing factors 8.PKM1 contains exon 9 but excludes exon6110,while PKM2 contains exon 10 and excludes exon 9.PKM1,which62hashighaffinityforitssubstratePEPandisnotaffectedbyallostericreg-63ulation,exists only as a highly active tetrameric form.However,PKM264exists in both a dimeric form with low affinity for its substrate PEP65and a tetrameric form with a high PEP affinity 9.Unlike the tetramer,66which has highly glycolytic activity,the inactive PKM2 dimer results67in the accumulation of glycolytic intermediates and consequently di-68verts them to biosynthesis of macromolecules such as nucleotides,69phospholipidsand aminoacids.The dimeric form ofPKM2 alsohas pro-70tein kinase activity,which is a great advantage in the regulation of gene71expression and tumourigenesis.A recent study demonstrated that72PKM2 is highly but not exclusively expressed in cancer tissues.The ex-73pression of PKM1 has been detected in many tumours as well using74mass spectrometry to absolutely quantify the level of expression 6.75Notably,accumulated evidence shows that PKM2 expression is closely76related to the clinical tumour stages and could be a predictor for the77prognosis of tumours 10,11.Cellular Signalling xxx(2014)xxxxxx Corresponding author at:Institute of Biotechnology,Key Laboratory of ChemicalBiology and Molecular Engineering of National Ministry of Education,Shanxi University,Taiyuan 030006,China.Fax:+86 351 7018268.E-mail addresses:(P.Yang),(Z.Li).CLS-08139;No of Pages 10http:/dx.doi.org/10.1016/j.cellsig.2014.03.0200898-6568/2014 Published by Elsevier Inc.Contents lists available at ScienceDirectCellular Signallingjournal homepage: citethis article as:P.Yang,etal.,Pyruvate kinase M2 facilitates colon cancer cell migrationvia themodulation of STAT3signalling,CellularSignalling(2014),http:/dx.doi.org/10.1016/j.cellsig.2014.03.020UNCORRECTED PROOF78With the changes in peoples lifestyles and improved living stan-79dards,colorectal cancer(CRC)remains the third most commonly diag-80nosed cancer and seriously threatens global health 12.Despite recent81advances in prognosis and medical technologies,the mortality rate of82patients suffering from metastatic disease remains high.The major rea-83son for this high mortality rate is that metastasis ultimately causes the84recurrence of tumours and patient death 13.Cell migration and adhe-85sion abilityare important characteristicsof metastatic tumourcells.The86process of tumour metastasis is a multistep process involving the loos-87ening of cellcell contacts,the enhancement of cellmatrix adhesion88and the degradation of extracellularmatrix components,mainly by ma-89trix metalloproteinases(MMPs)14.Although a few reports have fo-90cused on the relationship between PKM and tumour metastasis 15,91the effects and mechanisms of PKM1 and PKM2 in CRC on migration92and cellmatrix adhesion have not been elucidated.93Based on these reports,the present studies investigated the regula-94tion of PKM2 on the metastasis of colon cells.The data showed that95the inhibition of PKM suppresses cell migration and adhesion in DLD196cells.Furthermore,PKM2,but not PKM1,promotes DLD1 cell migration97and cellmatrix adhesion.Moreover,the overexpression of PKM2 can98upregulate STAT3 gene transcription and activate snail-2 signalling99and 1-integrin-FAK signalling,which facilitate DLD1 cell migration.100Interestingly,STAT3 is essential for PKM2 overexpression-induced me-101tastasis.In addition,the dimeric PKM2,which is independent of pyru-102vate kinase activity,plays a critical role in migration and adhesion-103associated signalling.Taken together,these data provide a new under-104standing of PKM2 in the regulation of CRC metastasis,and it may be a105useful target for novel therapeutic strategies for thetreatmentof malig-106nant CRC.1072.Materials and methods1082.1.Antibodies and reagents109RPMI-1640 medium,Dulbeccos modified Eagles(DMEM)medium110andfoetalbovineserum(FBS)werepurchasedfromInvitrogen(Carlsbad,111CA).RNAisoPlus,PrimeScriptRTMasterMixandSYBRGreenPCRMaster112Mix were obtained from Takara(Shiga,Japan).The nuclear and cytoplas-113micproteinextractionkitwaspurchasedfromBeyotimeBiotech(Beijing,114China).The Easy Mutagenesis System was obtained from Transgen Bio-115tech(Beijing,China).The pyruvate kinase assay kit was obtained from116Nanjing Jiancheng Bioengineering Institute(Nanjing,China).Actinomy-117cin D was obtained from Sigma(St.Louis,MO).E-cadherin antibody118was from Sino Biological,Inc.(Beijing,China).Phospho-STAT3Ser727119antibody was from Sangon Biotechnology(Shanghai,China).FAK anti-120body was from MBL(Nagoya,Japan).The active conformation of 1-121integrin(12G10)was purchased from Millipore(Bedford,MA).GFP anti-122body was from Beyotime(Shanghai,China).N-cadherin and Vimentin123were from Bioworld Technology(Minneapolis,MN).Snail-2,phospho-124FAKTyr397andPKM2antibodieswerepurchasedfromCellSignalingTech-125nology(Beverly,MA).PKM1 and STAT3 antibodies were obtained from126Signalway Biotechnology(Nanjing,China).GAPDH and PCNA antibodies127were from Abmart(Shanghai,China).HRP-conjugated secondary anti-128bodies were obtained from Invitrogen(Carlsbad,CA).1292.2.Cell culture130Human colon cancer DLD1 cells were purchased from American131Type Culture Collection(Manassas,VA)and cultured in RPMI-1640 me-132dium supplemented with 10%FBS.Then,cultures were incubated at 37133C in 5%CO2and 95%humidity.1342.3.Quantitative real-time PCR135Total RNA was extracted from cells using Trizol reagent.cDNA was136synthesised from 500 ng RNA with PrimeScript RT Master Mix.137Quantitative real-time PCR was performed using 2 SYBR Green PCR138Master Mix under the following conditions:95 C for 30 s,followed by13940 cycles at 95 C for 5 s,64 C for 34 s,and a melt curve step using a140Step One Plus Real-Time PCR System(Applied Biosystems).The target141gene expression levels for each experiment were normalised to142GAPDH.Therelativegeneexpressionlevels were detectedandcalculated143using the Ct comparative method.The RT-PCR primers used were as144follows:PKM1,5-GAAGAACTTGTGCGAGCCT-3(forward)and 5-CGTC145AGAACTATCAAAGCTGC-3(reverse);PKM2,5-GCTGCCATCTACCACT146TGC-3(forward)and 5-CCAGACTTGGTGAGGACGATT-3(reverse);E-147cadherin,5-GAACGCATTGCCACATACAC-3(forward)and 5-AACTCTCT148CGGTCCAGCCCAG-3(reverse);N-cadherin,5-TTTTGCCCCCAATCCTAA149GA-3(forward)and 5-CAGCGTTCCTGTTCCACTCAT-3(reverse);MMP-1502,5-TGGATGATGCCTTTGCTCGTGC(forward)and 5-ATCGTCATCAAA151ATGGGAGTCT-3(reverse);MMP-9,5-CACCCTTGTGCTCTTCCCT-3(for-152ward)and 5-AAGTCTTCCGAGTAGTTTTGG-3(reverse);Snail-1,5-153CCCAATCGGAAGCCTAACTAC-3(forward)and 5-GCCTCCAAGGAAGA154GACTGA-3(reverse);Snail-2,5-ACGCCTCCAAAAAGCCAAACT-3(for-155ward)and 5-GGGACTCACTCGCCCCAAAG-3(reverse);LEF-1,5-TTCC156TTGGTGAACGAGTCTG-3(forward)and 5-CTTTATTTGATGTTCTCGGG-1573(reverse);Twist1,5-GAGCAACAGCGAGGAAGAGC-3(forward)and1585-CGAGGGCAGCGTGGGGATGA-3(reverse);STAT3,5-TCTCAACTTCAG159ACCCGTCAACA-3(forward)and 5-ACAGCTCCACGATTCTCTCCTCC-3160(reverse);GAPDH,5-GCACCGTCAAGGCTGAGAAC-3(forward)and 5-161TGGTGAAGAACGCCAGTGGA-3(reverse).1622.4.Preparationofwholecelllysates,subcellularfractionation andWestern163blot analysis164Cells were lysed in RIPA buffer(1%Triton X-100,1%deoxycholate,1650.1%SDS)supplemented with 2 mM phenylmethylsulfonyl fluoride.166After centrifugation at 12,000 g for 15 min at 4 C,the supernatants167were collected as whole cell lysates.Cytosol and nuclei were isolated168using the nuclear and cytoplasmic protein extraction kit.In brief,cells169were mixed with cytoplasmic protein extraction buffer and vortexed170atmaximum speedandthenincubated for15minonice.Aftercentrifu-171gation at 12,000 g for 5 min at4 C,the suspension including thecyto-172plasmic protein was collected.Nuclear protein extraction buffer was173added into the pellet and then shaken violently.After incubation for17430 min on ice,the suspension was centrifuged for 5 min at 4 C at17512,000 g.The resulting supernatant was the nuclear fraction.Protein176concentrationsweremeasuredbytheBCAproteinassay.Equalamounts177of proteins were mixed with 5 SDS sample loading buffer,boiled for1785 min and separated using 10%SDS-PAGE followed by transfer to179PVDF membranes.The membranes were blocked with 5%skim milk180for 2 h at room temperature.After blocking,membranes were probed181overnight at 4 C with the indicated diluted primary antibodies.The182membranes were subsequently washed three times with Tris-buffered183saline containing 0.05%Tween-20(TBST)and incubated with HRP-184conjugated secondaryantibodies for 2hatroomtemperature.Thereac-185tion signal was detected with an enhanced chemiluminescence detec-186tion kit and radiographic film.1872.5.DNA construct,mutagenesis and cell transfection188To stably knock down PKM,DLD1 cells were infected by a lentivirus189bearingthe PKMRNA interference(shPKM(a)orshPKM(b)or control190(shcont)constructs.The RNA interference sequences were as follows:191shPKM(a)(sense,5-CCGGCGGGTGAACTTTGCCATGAATCTCGAGATT192CATGGCAAAGTTCACCCGTTTTTG-3;antisense,5-AATTCAAAAACGGG193TGAACTTTGCCATGAATCTCGAGATTCATGGCAAAGTTCACCCG-3),shPKM194(b)(sense,5-CCGGCGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGC195CCATCATCCACGTTTTTG-3;antisense,5-AATTCAAAAACGTGGATGATGG196GCTTATTTCCTCGAGGAAATAAGCCCATCATCCACG-3).These constructs197were obtained from Shanghai GenePharma Co.Ltd.(Shanghai,China).2P.Yang et al./Cellular Signalling xxx(2014)xxxxxxPlease citethis article as:P.Yang,etal.,Pyruvate kinase M2 facilitates colon cancer cell migrationvia themodulation of STAT3signalling,CellularSignalling(2014),http:/dx.doi.org/10.1016/j.cellsig.2014.03.020UNCORRECTED PROOF198The stable PKM knock down cell lines were obtained and stored in our199lab.200The DNA fragments encoding the PKM1 gene and PKM2 gene were201respectivelyamplifiedfromplasmidPKM1-pQE-30,whichwassupplied202by Professor Hu 16,and the cDNA of human DLD1 cells.The primers203for PKM(forward,5-CCG CTC GAG GCCACCATGTCGAAGCCCCATAGT204GAAG-3;reverse,5-CGC GGATCC CG CGGCACAGGAACAACACG-3),205which introduced the XhoI and BamHI restriction sites,were used to206obtain the above DNA fragment.This fragment was then cloned into207pLVX-AcGFP1-N1 and confirmed by sequencing.pLVX-AcGFP1-N1-208K367M,-K433E and-R399E were made using the Easy Mutagenesis209System produced by Transgen Biotech(Beijing,China)and confirmed210by sequencing.211cDNAs were co-transfected along with the psPAX2 packaging plas-212mid and the pMD2.G envelope plasmid at a 4:3:1 ratio into 293 T cells213using a Calcium Phosphate Cell Transfection Kit(Beyotime,China).214Lentiviral supernatants were harvested at 24 h and 48 h after transduc-215tion and used to infect DLD1 cells for 24 h using fresh culture medium216containing 8 g/mL polybrene.Then,5 g/mL puromycin was used to217select the stable cell lines.Quantitative PCR and western blotting were218performed to confirm PKM1 and PKM2 expression before the stable219cells were used in experiments.2202.6.Wound healing assay221For the wound healing assay,the indicated stable cells were seeded222in 24-well plates and grown to form a confluent monolayer.The223straight-linescratchwounds in themonolayer were made witha sterile224pipette tip.Cells were washed twice with PBS and then incubated in225RPMI1640 with 1%serum for 1 day to exclude the effect of the serum226on cell growth.Photographs were recorded at the indicated hours.The227percentage of wound healing was evaluated by comparing the scratch228gap