PMID：28972040.pdf

1 Downregulation of DNMT3A by miR-708-5p inhibits lung cancer stem cell-like phenotypes through repressing Wnt/-catenin signaling Tianchi Liu1$,Xiaoping Wu1$,Tong Chen1,Zewei Luo1,2,Xiaohua Hu1*1.State Key Laboratory of Genetic Engineering,School of Life Sciences,Fudan University,Shanghai 200433,China 2.School of Biosciences,University of Birmingham,Edgbaston Birmingham B15 2TT UK Running Title:miR-708-5p inhibits lung cancer stemness Keywords:lung cancer,cancer stem cell,miR-708-5p,DNMT3A,Wnt/-catenin signaling$:T.Liu and X.Wu contributed equally to this work.*:The correspondence should be addressed to Dr.Xiaohua Hu School of Life Sciences Fudan University Shanghai 200433,China Tel:+86 21 51630720 Fax:+86 21 51630720 Research.on September 29,2017.2017 American Association for Cancerclincancerres.aacrjournals.org Downloaded from Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.Author Manuscript Published OnlineFirst on September 28,2017;DOI:10.1158/1078-0432.CCR-17-1169 2 Translational relevance Lung cancer remains the leading cause of cancer death.Cancer stem cell(CSC)can drive cancer development,recurrence and therapy resistance.Understanding lung CSCs physiopathology should provide opportunity to prevent tumor development and improve their therapeutic management.MiRNAs represent an emerging class of target biomolecules considered as an alternative therapeutic approach in different types of cancers.In this study,we identified for the first time,that miR-708-5p effectively suppressed the cell stemness of lung cancer by targeting DNMT3A and then reducing the subsequent DNA methylation.MiR-708-5p was also demonstrated to act as a novel promising prognostic and diagnostic biomarker in NSCLC.Consequently,our finding of miR-708-5p-DNMT3A axis provided insights into pathologic mechanisms underlying NSCLC stemness,implying its clinical significance in developing targets for NSCLC prediction and therapy.Abstract Purpose:Lung cancer is the leading cause of cancer death in the world,and emerging evidences suggest that lung cancer stem cells(CSCs)are associated with its poor prognosis,tumor recurrence and therapy resistance.Here we reveal a novel role for miR-708-5p in inhibiting lung cancer stem cell-like features.Experimental Design:Phenotypic effects of miR-708-5p on the lung CSC-like properties were examined by in vitro sphere formation assay and in xenografted animal models.Immunoblotting,dual luciferase reporter,and immunocytochemistry were performed to determine the target of miR-708-5p.DNA methylation of CDH1 promoter region was tested using bisulfate sequencing.Genome-wide miRNA sequencing data of 990 patients from the cancer genome atlas(TCGA)dataset and 148 patients from China cohort were analyzed to excavate the pathogenic implications of miR-708-5p.Results:Expression of miR-708-5p inhibits the CSC traits of NSCLC cells in vitro while antagonizing miR-708-5p promotes tumorigenesis in vivo.MiR-708-5p directly suppresses the translation of DNMT3A,which results in a substantial reduction of global DNA methylation and the up-regulated expression of tumor suppressor CDH1.The up-regulation of CDH1 decreased the activity of Wnt/-catenin signaling and then impaired the stemness charactertics of NSCLC cells.Clinically,patients with high miR-708-5p expression show significantly better survival and lower recurrence.Furthermore,miR-708-5p has a promising potential to apply to differentiating histological subtypes in NSCLC.Conclusion:Our findings support that miR-708-5p suppresses NSCLC initiation,development and stemness through interfering DNMT3A-dependent DNA methylation.MiR-708-5p may function as a novel diagnostic and prognostic biomarker in NSCLC.Research.on September 29,2017.2017 American Association for Cancerclincancerres.aacrjournals.org Downloaded from Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.Author Manuscript Published OnlineFirst on September 28,2017;DOI:10.1158/1078-0432.CCR-17-1169 3 Introduction Lung cancer,the most common cancer in humans,causes more than 1 million deaths worldwide annually(1,2).Non-small cell lung cancer(NSCLC)accounts for over 85%of all lung cancer cases(3,4).For decades,surgical resection has been a mainstay in the treatment of NSCLC,proving more effective than chemotherapy and radiation and offering the greatest cure rate for early-stage(5).However,most patients will present with unresectable or noncurable disease or have a propensity for early dissemination and metastasis,resulting in relapse after surgery or radiotherapy(6-8).In view of this,the major challenge in NSCLC diagnosis is posed by the inability of current diagnostic methods to distinguish between indolent and aggressive tumors.Thus,there is an urgent need to identify NSCLC biomarkers with better prognostic and diagnostic potential.The introduction of molecularly targeted therapies has dramatically improved the outcomes in the metastatic setting for patients with NSCLC harboring somatically activated oncogenes such as EGFR(9,10)and translocated EML4-ALK(11,12).However,even with these therapies,most patients with NSCLC will not experience prolonged disease control,and the 5-year survival rate has remained poor at 15.9%(13).Therefore,a second major clinical challenge is the elucidation of pathways of tumor recurrence and metastasis of NSCLC,which could lead to the design of better therapeutic strategies.Tumor recurrence and progression in NSCLC has been associated with the existence of cancer stem cells(CSC)or tumor-initiating cells(TIC)within a bulk of tumor that are refractory to current therapies(14).CSCs are defined as self-renewing tumor cells able to initiate and maintain tumor and to produce heterogeneous lineages of cancer cells that compose the tumor(15).Recent studies show that certain microRNAs(miRNAs)exhibit promising therapeutic potential by suppressing both cancer cells and CSCs.Overexpression of miR-34a(16),miR-200c(17)and miR-582-3p(18)results in loss of CSC properties in several types of cancers,including lung cancer.A mimic of miR-34a,MRX34,encapsulated in liposomal nanoparticle has shown preliminary clinical evidence of anti-tumor activity in a Phase I clinical trial(19).More recently,our studies have demonstrated that miR-708-5p can weaken the stem cell-like properties of NSCLC(20).However,the underlying mechanism of how miR-708-5p affects the characters of CSCs remains unclear.Here,we uncovered that miR-708-5p can induce DNA hypomethylation by targeting DNMT3A and then reduce the stemness of NSCLC.MiR-708-5p was demonstrated to present a marked correlation with tumor progression,recurrence and poor survival outcome in the malignance,suggesting its clinical significance as a promisingly diagnostic and prognostic biomarker.Materials and Methods Cell lines Research.on September 29,2017.2017 American Association for Cancerclincancerres.aacrjournals.org Downloaded from Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.Author Manuscript Published OnlineFirst on September 28,2017;DOI:10.1158/1078-0432.CCR-17-1169 4 Cell lines A549 and Calu-3 were obtained from American Type Culture Collection and cultured under conditions provided by the manufacturer.Cell line 95D was obtained from the Cell Bank Type Culture Collection of the Chinese Academy of Science(CBTCCCAS,Shanghai).All the cells were authenticated by short tandem repeat DNA profiling upon initial receipt and periodically thereafter,and were propagated for less than 6 months after resuscitation.These cells were cultured at 37C under 5%CO2 in RPMI-1640(Invitrogen)supplemented with 10%FBS(Thermo scientific),and penicillin/streptomycin(Thermo scientific).Antibodies Antibodies used in the present study are as following:Dnmt3a(Santa Cruz),Dnmt3b(Abcam),-Tublin(Sigma),p21(Abcam),5-mC(Active Motif),CDH1(R&D),-catenin(Abcam),CD34(Abcam),CD133(Abcam).MiRNA mimics,inhibitor and sponge MiR-708-5p mimics and inhibitors are chemically synthesized in GenePharma company(Shanghai,China).MiRNA mimics are small,chemically modified double stranded RNAs designed to mimic endogenous mature miRNA molecules.The sequences of miR-708-5p mimics were 5 AAGGAGCUUACAAUCUAGCUGGG 3 for sense and 5 CAGCUAGAUUGUAAGCUCCUUUU 3 for antisense.MiRNA inhibitors are sequence-specfic and chemically-modified antisense oligonucleotides to specifically target and inhibit endogenous miRNA molecules through extensive sequence complementarity.The sequence of miR-708-5p inhibitors was 5 CCCAGCUAGAUUGUAAGCUCCUU 3.MiR-708-5p sponge was constructed with a method modified from previous reports(21).MiR-708-5p sponge was developed by inserting 4 tandemly arrayed copies of miR-708-5p binding sites into the 3UTR of a reporter gene encoding destabilized GFP driven by the CMV promoter,which can yield abundant expression of the competitive inhibitor transcripts,and established immortal cell lines by a lentivirus-mediated cell transformation technique.The single-copy sequence of miR-708-5p sponge was 5-CCCAGCTAGATTGTAAGCTCCTT-3.Sphere formation assay 500 cells were seeded in 6-well ultra-low cluster plates(Corning)and cultured in DMEM/F12 serum-free medium(Invitrogen)supplemented with 2%B27(BD Pharmingen),20 ng/ml EGF(Sigma)and 20 ng/ml bFGF(Sigma).The number of spheres(50 m)were counted after 7 days.Mouse experiments All animal experiments were performed according to the protocol of the Fudan Committee on Animal Care using 3-4-week-old female BALB/c nude mice.A549 cells transduced with lentiviral constructs Research.on September 29,2017.2017 American Association for Cancerclincancerres.aacrjournals.org Downloaded from Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.Author Manuscript Published OnlineFirst on September 28,2017;DOI:10.1158/1078-0432.CCR-17-1169 5 carrying either miR-708-5p sponge or sponge control,were harvested,washed with PBS and resuspended in normal culture medium with Matrigel(BD Pharmingen).The resulted cells were injected subcutaneously in the left and right flank of nude mice with two doses(1103,1104),respectively.The tumors were excised,weighted and sectioned after engraftment for 2 months,during which tumor volume was calculated using the equation(L*W2)/2 every 10 days.Each group of treated cells was injected into six nude mice.Luciferase assay For target gene assays,the predicted miR-708-5p binding region of human DNMT3A and DNMT3B was amplified using PCR and cloned into a pGL3 vector.Cells of 70%confluence in 24-well plates were transfected using Lipofectamine 2000.100 ng of constructed pGL3 vector,5 ng of pRL-SV40 Renilla luciferase construct(for normalization),and 100 ng of control mimics or miR-708-5p mimics were cotransfected per well.Cell extracts were prepared 36 hrs after transfection,and the luciferase activity was measured using GloMax(Promega).For-catenin activity assays,the pTOPflash(-catenin-TCF/LEF-sensitive)or pFOPflash(-catenin-TCF/LEF-insensitive)vectors(Promega)were co-transfected into A549 and Calu-3 cell lines with miRNA/siRNA using Lipofectamine 2000.The Renilla luciferase reporter vector pRL-SV40 was simultaneously transfected as the control for transfection efficiency.Cell extracts were prepared 36 hrs after transfection,and the luciferase activity was measured using GloMax(Promega).TCF-mediated-catenin activity was determined by the ratio of pTOPflash/pFOPflash luciferase activity,each of which was normalized to the activity of the pRL-SV40 reporter.Dot-blot analysis The genomic DNA of A549 and Calu-3 after transfecting of miR-708-5p or control were purified using AllPrep DNA/RNA/miRNA universal kit(Qiagen)and the concentrations were accurately determined by NanoDrop.Equal amount of DNA(1-2 g)from all samples was denatured in 1buffer(0.4 M NaOH,10 mM EDTA)at 100C and mixed with an equal volume of cold 2 M ammonium acetate.After the membrane was rehydrated with 500 l Tris-EDTA or H2O,the denatured DNA in a 50-500 l solution was loaded onto the membrane.Next,the membrane was washed by 2SSC buffer,baked at 80C for 2 hrs and blocked with 5%non-fat milk for 1 hr.The DNA spotted membrane was incubated with rabbit anti-5mC antibody(Active Motif)and the signal was detected by HRP-conjugated secondary antibody and enhanced chemiluminescence.After development,the membrane was hybridized with 0.02%methylene blue(Sigma)in 0.5 M sodium acetate(pH 5.0)to stain DNA as a loading control.Bisulfite sequencing analysis Research.on September 29,2017.2017 American Association for Cancerclincancerres.aacrjournals.org Downloaded from Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.Author Manuscript Published OnlineFirst on September 28,2017;DOI:10.1158/1078-0432.CCR-17-1169 6 Approximately 1 g of genomic DNA was modified with sodium bisulfite using EZ DNA methylation-gold kit(Epigenetics).The human CDH1 promoter region was amplified by EpiMark hot start taq DNA polymerase(NEB)using the bisulfite-treated DNA as template.The products were subcloned into pEASY-T3 cloning vector(Transgen biotech)and then sequenced for at least 10 colonies.The sequence results were analyzed in website QUMA(http:/quma.cdb.riken.jp/).miRNA-seq for NSCLC samples 148 paired NSCLC samples,named FDPQG(Population and Quantitative Genetics group of Fudan University)cohort,including 82 paired adenocarcinomas(LUAD)and 66 paired squamous cell carcinomas(LUSC),were collected between 2010 and 2014 at Shanghai pulmonary hospital in China.Samples were frozen in liquid nitrogen immediately after resection and stored in liquid nitrogen until the extraction of RNA.Tumors were classified according to the World Health Organization pathologic classification system.The clinicopathologic characteristics of patients were detailed in Supplementary Table S1.All patients provided informed consent and did not receive any therapy before surgery.Total RNA containing small RNAs was isolated from approximately 50 mg of tissue for each sample using AllPrep DNA/RNA/miRNA universal kit(Qiagen),according to the manufacturers instructions.RNA integrity and concentration were measured using RNA 6000 Nano Chip kit and the Bioanalyzer 2100(Agilent Technologies).Only RNA extracts with RNA integrity number values8 underwent further library preparation.For high-throughput miRNAs sequencing,small RNA libraries were established using TruSeq Small RNA Sample Preparation Kit(Illumina)according to the manufacturers protocols.Briefly,small RNA(18-30 bp)was purified from 10 g of total RNA by PAGE electrophoresis.After ligation with corresponding adaptors to their 3 and 5 ends,the small RNAs were subsequently reverse-transcribed into cDNA by SuperScript II Reverse Transcriptase(Life Technologies).The cDNA fragments were amplified using the adaptor primers for 12-15 cycles and the fragments of aro